Total genomic DNA was extracted from the epidermal layer of biopsies using proteinase K digestion followed by a standard Phenol/Chloroform extraction method [54] or using a DNAeasy tissue kit (Qiagen).
Genomic DNA was isolated from spleen and lung tissue using a DNAeasy tissue kit (Qiagen).
Therefore, genomic DNA was extracted from whole body using a DNAeasy tissue kit (Qiagen, Hilden, Germany) using established protocols [ 84] without any damage to the voucher specimens.
Total bacterial DNA was isolated from overnight cultures using a DNAeasy Tissue Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, except lysostaphin was added to samples, and they were incubated for at least 3 h at 37°C.
Following this step, the DNA was purified using a DNAeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions.
Genomic DNA was prepared using a DNAeasy Blood and Tissue Kit (Qiagen) and real time PCR was carried out on an I-Cycler (Biorad) for the Trap gene 5'TRAP (GTCTGTGGAACTGACGGCTGTAGATGGCTA) 3'TRAP (AGTGGCGGCCGCCCATGAATCCATCTGTGAGGAAGAGAG) and normalized to the Biglycan gene 5'-Biglycan (CAGAGCTTACACCCACTAACATACTC) 3'-Biglycan (CTCCGAAGCCCATAGGACAGAAGTCA).
We used a DNAeasy 96 well kit (Qiagen, Valencia, California) for DNA extraction, and quantified DNA concentration using a spectrophotometer (Nanodrop Technologies, Wilmington, Delaware).
Colonies were isolated using a pipette tip and briefly expanded in adherent cultures before isolation of genomic DNA using the DNAeasy kit (Qiagen).
Forty-two to forty-four hours after, a liver biopsy was collected and DNA was extracted using the DNAeasy kit, including all optional steps (Qiagen, The Netherlands).
