Your English writing platform
Discover LudwigExact(1)
The director, Quentin Tarantino, uses this template to trace Django's growth into an avenging lethal weapon.
Similar(59)
Use this template to show your customers or your friends t….
Use this template to engage your greater team, who may be supporting multiple products in the portfolio only when needed.
Small interfering RNA specific to the mouse hepc1 (ACAGAUGAGACAGACUACAdTdT) was described previously [ 25], and we used this template to design the corresponding shRNA (ACCGACAGATGAGACAGACTACATTCATGAGATGTAGTCTGTCTCATCTGTCTTTTT) with minor modifications (Invitrogen, Shanghai, China).
Use this template to guide your markings.
You'll use this template to cut your photo down to the right size.
Use this template to cut out a circle of plain fabric.
The success of the intervention, which was adopted locally and is in the process of being adapted to other VA settings, may be attributable both to the reduced time burden of using this template, as well as to improved alignment of daily workflow and training goals, through a heuristic checklist that accurately reproduced shared communication patterns.
Remember that when using this template, everything is open to your own interpretation and needs to be tailored towards you.
We were able to use this template because our Parkinson's disease patients did not present any atrophy, as attested by the preoperative MRI.
Know that there is a time and place to use this template.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com