Sentence examples for used translation from inspiring English sources

Nevertheless, it's probably the most widely used translation app and is powered by Google's behemoth worldwide computing power and data sets.

One of the master German stylists of the 20th century, Freud wrote colloquially; the commonly used translation ("The Standard Edition of the Complete Psychological Works of Sigmund Freud," edited by James Strachey and published by Norton) imposes pseudoscientific terminology on his prose.

Some of the steps involved in a systematic design technique include a definition of what is required with the inputs and outputs specified, a definition of the algorithm to be used, translation of algorithms into instructions that can be inputted to the PLC, and testing and debugging of the program.

This is likely to involve the following: a definition of what is required, a definition of the algorithm to be used, translation of the algorithm into instructions for the PLC, testing and debugging of the program, and documentation to ensure that any person using the program can understand how it works.

Apple itself has used translation layers and intermediate APIs.

Based on Centeno-Cortes and Jimenez Jimenez (2004), having used translation, the learners may realize that the line of reasoning deployed was futile, abandoned it and endeavored to find an alternative path.

For this study we thus used translation-back-translation procedures [ 19] to translate into French both the CM (M.R., co-author) and the RAS (P.C., co-author) and to explore possible convergent validity between the measures of citizenship and recovery.

A second previously used translation-blocking antisense morpholino against Sox10 (GCCACAGGTGACTTCGGTAGGTTTA; Dutton et al., 2001a) targets the −43 to −19 region of the Sox10 sequence.

A previously used translation-blocking antisense morpholino against Sox10 (ATGCTGTGCTCCTCCGCCGACATCG; Dutton et al., 2001a, 2001b; Prasad et al., 2011; Whitlock et al., 2005) targets the −23 to +2 region of the Sox10 sequence.

We used translations of eight papers published in Chinese to assess eligibility.

Alternatively, languages can be translated using translation tools, but this would necessitate additional cost and time.