Sentence examples for used to induce from inspiring English sources

The high-temperature annealing treatment used to induce Zr segregation is also useful for promoting AIF formation.

The techniques used to induce hypnosis share common features.

In surgery, it is used to induce rather than maintain anesthesia.

Single, 6-h exposures of CBS5829-synX cells to β-estradiol were used to induce SCRaMbLE.

The targeting sequence GAGAACTGATCGATGTATCT was used to induce the double strand break.

Carbon dioxide infrared lasers are used to induce and alter chemical reactions and in isotope separation.

Doxycycline (Sigma) in 1 µg/ml concentration was used to induce knock-down of MLK4.

Drugs commonly used to induce labor also markedly increase the risk of rupture, studies have found.

In Japan applications of gibberellic acid are used to induce seedlessness in certain grapes.

TGFβ1 was used to induce fibroblast to myofibroblast transdifferentiation in pHCSFs5.

Lower concentrations of arabinose were used to induce aggregation-prone proteins.