Sentence examples for used to detects from inspiring English sources

Exact(2)

In this assay, the spectral analyses reveal that normal organ fluorescence spectra is similar to cancerous one but has not the intensity peak and moreover, specific binding probes to metastases confirm by Fig. 13 and their reports display the QD-AFP-Ab probes can be used to detects of small lung metastases and HCC lung metastases model (Chen et al. 2008; Yu et al. 2007a, b).

The primers used to detects 18S rRNA were: 5' GTAACCCGTTGAACCCCATT (forward) and 5'CCATCCAATCGGTAGTAGGG (reverse).

Similar(58)

Finally, outlier detection can be used to detect malicious requests.

There are a number of red flags that can be used to detect possible smuggling activity.

They invented a motorized wheelchair equipped with radar or sonar sensors used to detect obstacles.

Virtually all the systems used to detect gene variations rely on P.C.R.

(Dr. Carling has applied for patents on the solution the study used to detect cleaning).

Pap smears are used to detect cervical cancer, spread by the human papillomavirus (HPV).

The iPad's microphone is used to detect whether players are in tune or not.

In 1998, he used uranin, a dye used to detect plumbing leaks, to colour a Berlin river green.

It also can be used to detect renal vascular disease.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: