Sentence examples for used to detected from inspiring English sources

ECL Western Blotting detection reagent (Amersham Biosciences - GE Healthcare Europe GmbH, # RPN2106) was used to detected the signal.

Real-time PCR was used to detected miR-27a and Forkhead box O3a (FoxO3a) levels in the hippocampus.

Besides, the probe 1 also was used to detected the target ions in real water sample and living cells successfully.

SSR marker RM28561 (F: CTTCAAGACTGGCCCAATATTACTGC and R: TGACTGAAGCCTTCTTCACTTGC) and PCR-based marker B121 were used to detected the presence of the Bph21 gene (Rahman et al. 2009).

SSR marker RM16553 (F: CATAGCCACTTATCGTTGTTACGC and R: TGTCCATCTATGACTGTCCACTACG) and Indel marker HJ34 (F: GCCGAATGGTAAGAAGAG and R: GCGAGTTAACCAATGCTTGG) were used to detected the presence of the Bph20 gene.

The Roche Nimblegen Whole Human Genome Expression profile microarray was used to detected representative gene expression profiles of hDPSCs by ginsenoside Rg1.

There are a number of red flags that can be used to detect possible smuggling activity.

They invented a motorized wheelchair equipped with radar or sonar sensors used to detect obstacles.

Virtually all the systems used to detect gene variations rely on P.C.R.

(Dr. Carling has applied for patents on the solution the study used to detect cleaning).

Pap smears are used to detect cervical cancer, spread by the human papillomavirus (HPV).