Sentence examples for used to append a from inspiring English sources

Suggestions(1)

Exact(2)

The rule can be used to append a hypothetical action (action a n in the rule) to the scenario under construction to alleviate any incompleteness of information in the aggregated network evidence.

This strategy can be used to append a T7 promoter to the 5' end of the oligo(G) primer[ 13, 15], facilitating RNA amplification by IVT.

Similar(58)

To address this problem, genetic engineering was used to append VCN to a 73.6 kDa protein polymer called A192.

The peptide contains three primary amines (the N terminus and two lysine side chains), and these are used to append three gadopentetate dimeglumine moieties via a thiourea linkage [ 54].

This article describes the synthesis of furan- and thiophene-based chromophores bearing a terminal aldehyde function which was used to append them to polyvinyl alcohol (PVA) and thus obtain photosensitive polymers.

The attribute evaluator is used to append weight to each feature according to its ability to distinguish the different classes.

The transmission equation for a CFO-distorted single-input single-output (SISO) link is given by (1). is the data vector comprising the data symbols constituting the OFDM symbol, is the discrete Fourier transform (DFT) matrix, and and are permutation matrices used to append and cut the cyclic prefix (CP) of length samples.

In the second PCR reaction, the forward primer 5' GGGGACAAGTTTGTACAAAAAAGCAGGCT 3' and the reverse primer 5' GGGGACCACTTTGTACAAGAAAGCTGGGT 3' were used to append sites for homologous recombination at the end of the PCR products.

One of the commonly used methods to append a F-18 atom involves conjugating a fluoroalkyl group to the compound; however, the results were not always promising.

Meanwhile, Facebook plans to use this information to append a "Political Ad" label and "Paid for by" information to all election, politics and issue ads.

Because Cytoscape does not support fuzzy key matching, we used our Python script to append a key column to the p-value matrix to utilize the Cytoscape table merge tool.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: