Sentence examples for used this template from inspiring English sources

We used this template as a basis for automated registration and realignment of the scans done for the subjects in the study.

Small interfering RNA specific to the mouse hepc1 (ACAGAUGAGACAGACUACAdTdT) was described previously [ 25], and we used this template to design the corresponding shRNA (ACCGACAGATGAGACAGACTACATTCATGAGATGTAGTCTGTCTCATCTGTCTTTTT) with minor modifications (Invitrogen, Shanghai, China).

Remember that when using this template, everything is open to your own interpretation and needs to be tailored towards you.

Then, using this template from Scholastic as a guide, compose your "Where I'm From".

Label it with key terms such as magma chamber, main vent and crater, and encourage pupils to compile a glossary using this template.

The director, Quentin Tarantino, uses this template to trace Django's growth into an avenging lethal weapon.

Use this template to show your customers or your friends t….

Using this template, they were able tease out B-modes in the data itself.

The subjects using this template structure had better results in terms of time spent.

The subjects using this template structure had better results in terms of accuracy; ERQ2: Which of the evaluated template structures requires less time to understand a use case?

In this way, NW growth is controlled especially epitaxial growth oriented at (200) which is impossible for free standing growth to be achieved by using this template method.