Sentence examples for used on corresponding from inspiring English sources

Then, different fusion processes are used on corresponding components.

siRNA studies used ON-TARGETplus Duplex J-008013-06-0020 correspondITGB7o human ITGB7 with sense sequence 5' CCACAUUUCUUACGAAUCCUU 3' and antisense sequence 5' PGGAUUCGUAAGAAAUGUGGUU, and ON-TARGETplus siCONTROL non-targeting siRNA served as a negative control (Dharmacon, Lafayette, CO).

Additional File 1, SBEI Guide, defines amount used with small corresponding to containers used on workbench, medium corresponding to drum scale, and high for large amounts used on a vat scale.

During training, a one-vs-all r.b.f. kernel support vector machine (SVM) is used on the normalised histograms corresponding to each object.

These vintage plates aren't street-legal, though some states allow them to be used on classic cars of corresponding years.

The bands used on each link and the corresponding flow (bits/s/Hz) are indicated in the figure.

The corresponding terms used on English-language forums (e.g. ecigarette-forum.com) are "vaping" and "vaper".

The analysis of disease resistance QTL locations in the soybean genome using data on corresponding molecular markers (http://soybase.org/) confirmed a strong bond between these sites and the Hsp20 genes.

Moreover, other discretization methods (such as the backward Euler method, the nonstandard finite difference scheme) can be used on model (1) to obtain the corresponding discrete model.

Finally, BSs jointly decide on the transmission strategy to use on subchannel and the corresponding user(s) to schedule on the subchannel.

For imputed SNPs, we used the corresponding test based on the estimated allele dose.