Your English writing platform
Discover LudwigSuggestions(1)
Exact(5)
The visual references used, meanwhile, range from, "a telegram envelope to a double copy of a late Cezanne landscape".
In addition, in Method I, a current sensor is used meanwhile a voltage sensor is used in Method II.
The three multifractal spectrums were quite distinctive when the maximum resolution was chosen and the GC method was used, meanwhile the CC method obtained the MFS of Chisel and Roller too close to be differentiated.
At all times of reaction, the predominant phase turn out to be the LDH structures when LS pozzolan was used; meanwhile for the IS pozzolan the C4A¯¯¯CH12 along with the LDH were the main phases during the first 28 days.
To detect TMV positive RNA, the specific RNA probe sequence (5′ 3′) TTAAGTTGCAGGACCAGAGG was used; meanwhile, as a control, the unrelated RNA probe sequence (5′ 3′) AATTCAACGTCCTGGTCTCC was used.
Similar(53)
Cessna's sales of used aircraft, meanwhile, rose and the number of used planes on offer dipped, but only modestly.
Car use, meanwhile, has rocketed.
"Using", meanwhile, equates social media with heroin abuse.
Natural gas use, meanwhile, would increase by 15 percent from current levels by 2035.
Heavy electricity use, meanwhile, could be limited by imposing power-usage standards on electronics manufacturers, as exist for refrigerators and washing machines.
The system was tested in Iran for drying apricots, heating rural residential buildings and supplying hot water for domestic use, meanwhile, the energetic and exergetic efficiency of the system was calculated 37.3 61.3 and 3.2 9.7 respectively for different types of installations.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com