Sentence examples for used for each sequence from inspiring English sources

Note that 50 interpolated frames are used for each sequence.

Table 1 indicates the primers used and the source of the template DNA used for each sequence accession.

Sequence reads with Solexa 3' adapter (the read length being 36 nt) were picked for miRNA mapping (the same adaptor being used for each sequencing run).

Bisulphite treated DNA was used for generating PCR amplified templates for pyrosequencing using the following forward primer: 5'TGandATGGGTTTTTGTTTGGTAT3' and biotinylated reverse primer 5'TCCTCAATCCACCCAAAATAATAT3'. 10 uL of the biotinylated PCR product was used for each sequencing assay using the following sequencing primers 5'GGGGTGGAGGGTGTA 3' and 5'-AAAAGTTATTGGATATATAGT 3'.

A PCR product (25  μl) was used for each sequencing reaction.

20 30 ng of the DNA was used for each sequencing reaction (8 μl) together with 2 μl BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit V.1.1 (Applied Biosystems, Rotkreuz, Switzerland) and 4 μM of each primer.

Table 2 shows the error characteristics and read lengths used for each sequencing technology, along with the fraction of the genome that has either a low or high GMS value (runtime performance is shown in Supplementary Table S1).

Four different evolutionary models were used for each seed sequence (JTT, WAG, Blosum62 and VT).

If more bits are used for each protein sequence, then a higher degree of resolution is obtained.

A list of transitions used for each (phospho peptide sequence is available as Supplementary file 1C.

Four different read datasets were used for each gene sequence: no mismatch, up to one mismatch, up to two mismatches, and up to three mismatches.