Suggestions(1)
Exact(1)
Genotyping by ERIC-PCR [ 17] was also performed to verify that the isolates belonged to the type strain used for contamination.
Similar(59)
Common pollution indices, such as Contamination factor (Cf), degree of contamination (Cd), modified contamination degree (mCd), potential ecological risk index (RI) and metal pollution index (MPI), were used for assessing contamination status.
In the last decade, different kinds of in-situ methods have been increasingly used for hydrocarbon contamination remediation due to their effectiveness.
As an approach, the models used for a contamination tolerant bonding process were inversely used and adapted with focus to the CFRP production and its process parameters to achieve the general goal, namely to subsequently reduce the release agent transfer by an adapted processing of the CFRP-system.
Some of the causes of population decline may be increased predation by gulls and skuas, the introduction of rats, cats, dogs and foxes onto some islands used for nesting, contamination by toxic residues, drowning in fishing nets, declining food supplies and climate change.
Twenty additional markers were used for cross contamination analysis.
Certified standard of imidacloprid (99.8% chemical purity) was purchased from Sigma-Aldrich (Germany) and used for the contamination of soil.
The adapter sequence used for the contamination check was as follows: CGAGATCGGAAGAGCACACGTC, i.e. meCG end repair ± A tail ± 10 bp of Illumina adapter sequence.
All organs used for artificial contamination experiments were tested to be negative for L. monocytogenes prior to inoculation using the Matrix-Lysis protocol and the real-time PCR assay described by Rossmanith et al. [ 32].
Each data point in the figures represents the predicted value ŷi for log10 (recovered CFU/CFU0) for the time and treatment based on the regression analysis, where CFU0 is the amount of Salmonella used for artificial contamination.
Using dates, we apply commonly used algorithms for contamination episodes based on the likelihood of a given microbial species to originate from the skin flora versus the bloodstream, 11 characterizing the remaining BCs as representing true bacteremia.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com