Sentence examples for used for amplifying from inspiring English sources

Primers used for amplifying Vap33-1 specifragmentsents were: CCGGCCGTCAAACAGGTG and TGCCCAGCAGGAGGCTAACG. Primers used for amplifying E74 specific fragments were: GGAGCGAATGGACAAGCTCA and GCTGTTGCAGGTGGTGCT.

The specific primers used for amplifying open reading frame of BdPho (forward, 5′-TTTCACACACCTCAGTAAACTTTCT-3′; reverse, 5′-TTATTCCCCTCTCTTCAGTCGT-3′) were synthesized by Invitrogen in Shanghai, China.

The primers used for amplifying each gene were listed in Table S18.

Primers used for amplifying specific genes are shown in Table 1.

However, the primers used for amplifying a specific product representing Ssa-NILT6 were very difficult to design due to high similarity between NILT genes in the BAC sequence.

A patch-clamp amplifier (Dagan, Minneapolis, MN) was used for amplifying currents.

This amplifier has a compact structure and is mainly used for amplifying the displacement of the piezoelectric actuator.

The specific process used for amplifying circularized asMIPs was tailored to the method of quantitation; for arrays, MIPs were amplified with biotinylated PCR primers before being hybridized to microarrays.

They also differ from great apes in having longer arms, dense hair, and a throat sac used for amplifying sound.

A biotin-streptavidin (SA -gold nanoparticleSA -gold) system designanoparticlesork wAuNPsed for amplifying resystem signal of the sensor.

The choice of 5′ non-homologous extensions in primer pairs used for amplifying the marker cassettes determines the site specificity of the targeting DNA.