Sentence examples for used begin with from inspiring English sources

The two custom 60-mer primers used begin with 40 nucleotides that are identical to the upstream or the downstream region of ABZ1 followed by 20 nucleotides that can amplify the KanMX4 module, ABZ1 forward: ATGCTGTCCGATACAATTGACACAAAGCAACAACAGCAACTTCGTACGCTGCAGGTCGAC; and ABZ1 reverse: CTACATGAAAATTTGCAAGTTGCTCTCCAACTTGGTGTACGCATAGGCCACTAGTGGATCTG.

This title was used beginning with the Kievan princes of the house of Rurik in the 10th century and was gradually assumed by the rulers of other principalities.

A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE).

Snowball sampling was used, beginning with obvious stakeholders and information was obtained from semi-structured interviews.

A manual stepwise approach was used, beginning with a univariate testing (α = 0.05).

Test order is important, 30 and a predetermined sequence will be used beginning with non-noxious stimuli.

Similar workflows were used beginning with identical tissue and methodology for total RNA extraction and quality assurance checks [ 81].

The progressive method will be used, beginning with smaller loads that will be progressively increased until participants can no longer generate the torque required for completing 10 repetitions.

A sequential explanatory mixed methods design [ 52] was used, beginning with a cross-sectional online survey, followed by individual semi-structured interviews.

A touch down PCR program was used beginning with 5 min at 94°C, followed by 12 cycles of 30 s at 94°C, 60 s at annealing temperature 67°C, 60 s at 72°C with the annealing temperature decreasing by 1°C per cycle, followed by 29 cycles of 30 s at 94°C, 60 s at 55°C, 60 s at 72°C and 10 min at 72°C.

The two custom-made 60-mer primers used began with 40 nucleotides identical to the upstream or downstream region of the HO gene, followed by 20 nucleotides for amplification of the KANMX6 and NATMX4 cassettes (Forward primer: ATGCTTTCTGAAAACACGACTATTCTGATGGCTAACGGTGCTTCGTACGCTGCAGGTC and Reverse primer: TTAGCAGATGCGCGCACCTGCGTTGTTACC ACAACTCTTTAGTGGATCTGATATCACCTA).