Sentence examples for used began from inspiring English sources

In April 2010, Krista, a gay, 39-year-old marketing executive in the Bay Area (who asked that only her first name be used), began trying to conceive with Arsenault's sperm.

The territorial and the provincial roads, which are the most used, began to be sealed in the 1970s in the south and in the 1990s in the north.

Immunization schedules and the type of vaccine used began to differ in each country, leading to disparities in pertussis vaccination histories.

The two custom-made 60-mer primers used began with 40 nucleotides identical to the upstream or downstream region of the HO gene, followed by 20 nucleotides for amplification of the KANMX6 and NATMX4 cassettes (Forward primer: ATGCTTTCTGAAAACACGACTATTCTGATGGCTAACGGTGCTTCGTACGCTGCAGGTC and Reverse primer: TTAGCAGATGCGCGCACCTGCGTTGTTACC ACAACTCTTTAGTGGATCTGATATCACCTA).

Four more test flights are scheduled before the rocket is used beginning in 2015.

Texas' law will force drillers to post the chemicals and the amounts used beginning in July 2012.

A "ghoul --or a "thinghoul --orord "zombie" is never used) beghoul --orling toward Barbra.

The Philadelphia Mint's mint mark "P" was used beginning in 1980.

Snowball sampling was used, beginning with obvious stakeholders and information was obtained from semi-structured interviews.

A manual stepwise approach was used, beginning with a univariate testing (α = 0.05).

Herbal remedies for facilitating childbirth were reported to be used beginning in the seventh month of pregnancy.