Sentence examples similar to used amply from inspiring English sources

Similar(57)

It's widely used and amply tested.

The primers pairs of PET-F1 (CTCACCCATATG GAAGGTGAGGCCTCTGGGCA) and PET-R1 (GGCAATGAATTC CTATCACTGGCTAGCCGACA) were used to amply 1S sh x2.9 while the combination PET-F2 (CTCATCCATATGGAAGGTGAGGCCTCTAGGCA) and PET-R2 (GGCAAT GAATTCCTATCACTGGCTGGCCGACA) were specific for y-type genes of 1S sh y2.3.

Schubert used that technique amply in "Death and the Maiden" Quartet (D. 810), along with more characteristic melodic flights.

β-tricalcium phosphate (β-TCP) is amply used for SFA.

In this regard, the amply used model is the Poisson model with the assumptions that seismic occurrences are spatially and temporally independent and the probability that two seismic occurrences will take place coincidentally approaches zero and at the same location.

Classification trees have not been amply used in an ICU setting.

And I believe that, in the lingo of Gartner's Hype Curve, Google Wave has reached the foothills of the "Slope of Enlightenment": the product is mature enough that real use cases are emerging, and these use cases amply illustrate the new technology's benefits.

Beal is amply using the Federal Deposit Insurance Corp. to attract small deposits; he isn't approved for the wholesale version of deposit insurance, which goes by the name of Temporary Liquidity Guarantee Program.

Companies can now suffer substantial losses when their products are improperly used even when users are amply warned.

However, as their use involves greater complexity with respect to the capabilities of clinical care installations, it would probably not be a good strategy to entirely discard criteria similar to those proposed by Waterstone in order to end up with a wider range of criteria that could be amply recommended and used in different contexts, including the reality of many developing countries.

The resulting DNA fragments were used as templates to PCR-amply the 5'-flanking sequences of the four P450 genes using the two general forward primers complementary to the adapter sequences and the two corresponding gene-specific reverse primers (see Additional file 1) for each P450 gene.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: