Sentence examples for used a negative control from inspiring English sources

Microvesicle-free plasma (pellet supernatant) was used a negative control, and urokinase (Euromedica, Diegem, Belgium) was used with a range from 0.005 U to 0.5 U. Absorbance variations were measured for 18 h at 405 and 490 nm at 37 °C with a thermostated spectrophotometer (Versamax).

Myoglobulin was used a negative control for GR chromatin occupancy: CCTCACATGGGCAGCTATTT (myoglobin forward); GCTTGTGCAAGTCCAGACAG (myoglobulin reverse).

Fluorescence-positive erythrocytes were not observed among erythrocytes used a negative control (Fig. 4a).

DNA from leukaemia Raji cells was used a negative control.

There was no increase in dye release overtime in the presence of ethanol which was used a negative control.

We used a negative control inhibitor based on Caenorhabditis elegans miRNAs not found in humans (miRIDIAN miRNA hairpin inhibitor negative control).

No signal was observed using a negative control antibody (normal mouse IgG).

In general, all studies reported using a negative control.

GST was used as a negative control.

PBS was used as a negative control.

DMSO was used as a negative control.