Suggestions(1)
Exact(3)
by exploring midwives' communication techniques intended to promote a wellness focus in the antenatal period, this study identified strategies midwives use to amplify women's own resources and capacities, with the aim of reducing antenatal anxiety.
Centralized Singing Leads to Centralized Leading The Singing Core also creates an incredible powerhouse that you, as ba'al tfilah, can use to amplify your voice, and, by extension, your musical intentions.
The oligonucleotides we use to amplify ERβ1 mRNA were as follow: hERb1 sense: 5'TGCTTTGGTTTGGGTGATTGC3'; hERβ1 anti-sense: 5'TTTGCTTTTACTGTCCTCTGC3'. The housekeeping aldolase mRNA was used as an internal control.
Similar(55)
This electrical current is quite weak and thus front-end amplifier is used to amplify it.
SDL's main products are lasers that are used to amplify signals on fiber optic networks.
These are generally used to amplify microwave signals over broad bandwidths.
Many products and services exist to protect large networks from DDoS attacks and prevent network resources from being used to amplify attacks.
In Germany, music as a vehicle for uplift underwent a hideous reprise; Beethoven and Wagner were used to amplify the Nazi cause.
And she focusses on the role of the activist leader Bayard Rustin, who was fixated on the audio equipment that would be used to amplify the day's speeches.
The festival, supported by BT, will feature personal stories – ones used to amplify wider themes about some of the issues, and changes, we are all facing.
was used to amplify the generated signal.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com