Sentence examples for use of a forward from inspiring English sources

Further use of a forward selection scheme for transferring a choice subset of tasks instead of transferring all tasks further increased the recognition accuracy to 74.5% accuracy in leadership and 81.3% accuracy in the extraversion personality traits.

When the no-arbitrage condition is satisfied without the use of a forward contract to hedge against exposure to exchange rate risk, interest rate parity is said to be uncovered.

When the no-arbitrage condition is satisfied with the use of a forward contract to hedge against exposure to exchange rate risk, interest rate parity is said to be covered.

The following equation represents covered interest rate parity, a condition under which investors eliminate exposure to foreign exchange risk (unanticipated changes in exchange rates) with the use of a forward contract – the exchange rate risk is effectively covered.

If these two returns weren't equalized by the use of a forward contract, there would be a potential arbitrage opportunity in which, for example, an investor could borrow currency in the country with the lower interest rate, convert to the foreign currency at today's spot exchange rate, and invest in the foreign country with the higher interest rate.

The insert sequences of the HVGGSSV-specific phage clones were amplified with polymerase chain reactions (PCR) by use of a forward primer (5'- GGandTGTCGTaTCCAGTC-3') and a reverse primer (5'-TGGATTGACCGGAAGTAGAC-3').

Even without it, he still has a place in the national side; one can always make use of a bruising forward willing to do yeoman's work.

But they just conceded validity of his 1998 use of a Merrill Lynch forward contract to lock in $82 million of Ciber gains and defer tax.

The first modification was the use of a new forward primer (TAAAGACGATCCTTCAGTGAGC) to replace the spa-1113f primer used for spa-PCR and sequencing which has a sequence mismatch at the 16th position with all known spa gene sequences.

Similarly, the use of a tailed forward primer and a standard length reverse primer in the M13-tailed primer method can promote the amplification of non-specific products.

With the use of a stepwise forward analysis that included all predictors, first baseline HbA1c and then only peroneal MCV at baseline entered significantly (R = 61%).