Sentence examples for use nomenclature from inspiring English sources

A Fire Risk Index (FIRISK) based on an original land cover/land use nomenclature has been developed in the framework of EU-funded MEDALUS projects and integrated into a composite index of sensitivity to desertification (the so called environmentally sensitive area index: ESAI).

We chose to use nomenclature that maintains continuity with the literature.

We will use nomenclature described in Figure 2 to refer to different data elements: d1 and d2 refer to measurements collected in 2001 and 2002, respectively; c1 and c2 refer to contextual data, such as month and proximity to oil and gas infrastructure, for each measurement in 2001 and 2002, respectively.

Genetic variants should be described using widely-used nomenclature [ 49].

To determine the incidence of uterine tachysystole (UT) using nomenclature defined by the American College of Obstetricians and Gynecologists (ACOG) and Association of Women's Health, Obstetric and Neonatal Nurses (AWHONN).

They also used nomenclature rules as features and carried out extensive automatic post-processing of the results (e.g. checking if brackets are balanced within the chemical name).

With so much investment headed toward Porsche's first all-electric vehicle, the German automaker is smartly using nomenclature familiar to its existing customer base, many of whom have never owned an EV.

Using nomenclature consistent with that study, we employed the following primers: GSP 1, ACCCTTCTTCTAACGGC; GSP2, TTTCGTGCGGCAAACGAAGTC; and GSP3, TGAATTCATCTCAAATCTCG.

The previously used nomenclature (SytA, SytB, SytC etc).

The used nomenclature is recommended by the Gene Nomenclature Committee of the Human Genome Organisation.

Labels for rhs genes were assigned using nomenclature described by Jackson et. al. (2009).