Sentence examples for use for a reference from inspiring English sources

They're people I can't use for a reference until their kids are out of the school system".

To implement this, we introduce a representative viewpoint (RV), which is a discrete point in the 3D map used for a reference point of rendering.

Tannic acid (Sigma, USA) was used for a reference curve.

The following primers were used for a reference gene, CquiOrco: forward, GCCGGATACGTTTTCTCCTTC; reverse, GCGCATAATTCCCTTCAGATG.

"A lot of people use it for a reference point," said Martin Foley, the electrician who services the sign.

Ask your customers if you can use them for a reference.

After you acquire a few cleaning positions ask the clients if you can use them for a reference.

Most of the time they are more than willing to let you use them for a reference.

The barley genome was used for a reference-guided assembly and differential expression analysis.

Since CHARON's use for a time reference does not require high precision, a simpler solution may be used.

The exergy destructions in the system are quantified and illustrated using tables for a reference temperature of 6 °C.