Microsatellite markers were amplified using polymerase chain reaction (PCR) in a 10 μl reaction using a multiplex PCR kit (Qiagen Inc .. PCR conditions for each reaction using the multiplex kit were 5 μl of Qiagen Master Mix (containing HotStarTaq DNA polymerase, dNTPs and 3 mM MgCl2), 0.625 μM of each primer, and 3 μl of genomic DNA.
PCRs were carried out using a multiplex PCR kit (Qiagen, Germantown, Maryland, US) in 5 μL final volumes and using 5 ng of DNA as template.
Using a multiplex PCR assay, X. oryzae pv.
The identification results obtained by ribotyping corresponded to those collected by using a multiplex PCR protocol specifically designed for C. jejuni and C. coli detection.
Then, PCR products were generated from two single-sources, mixed samples and artificially degraded DNA samples using a multiplex PCR system, and were prepared for sequencing on the MiSeq system through construction of a subsequent barcoded library.
SCCmec type assignment was performed using a multiplex PCR method, as described previously [22].
SCCmec typing was performed using a multiplex PCR strategy with sets of region-specific primers as previously described [37].
All blood and CSF samples were assayed using a multiplex PCR assay for the detection of N. meningitidis, H. influenzae and S. pneumoniae as previously described [18].
We investigated the presence of maternal cells in each child's circulation using a multiplex PCR for four Short Tandem Repeats Loci (vWA, D8S1179, TPOX, FGA) and a sex-identification marker (Amelogenin locus) discriminated by fragment analysis.
Genotyping for the Inpp4awbl mutation was performed using a multiplex PCR reaction with allele specific primers: wtF 5'CTACGGATCCTGGCGCAGA, wtR 5'CTGTCGTAGGCACGTGCTCA, mutF 5'AGTGTCAGGCACTGCTTGGA, mutR 5'GAGGGACGCTCTCTGACATT, resulting in the following bands: wild type, 135 bp; mutant, 277 bp.
