Subtracting administrative costs of 0.4% leaves a usable return of 5.5%.
I could delay buying the ticket until just a few days before he was scheduled to return, and thus get a usable return ticket, but then I wouldn't be buying the ticket 14 days in advance, and the fare would go back up over $300.
If, in fact, the 54.7% usable returned questionnaires were a perfectly representative sample, then the two surveys were in complete accord.
Response rate was defined as the number of usable returned questionnaires expressed as a percentage of the issued sample.
In order to maximize usable returned sequence data, a combination of three primers were utilised separately for each clone: C.elegans RNAi F from the Source BioScience library, forward 5′ ggagaccggcagatctgata, and reverse 5′ ggcctcttcgctattacgc.
Based on more than 1,700 usable surveys returned, here is what the researchers were able to divine about the types of people who do -- or do not -- buy products online: Shopping Lovers (11.1percentt of Internet users) Enjoy shopping online and do so frequently; encourage friends to buy online, too, so they are an attractive target for online retailers.
As a solution, endurance crews not only received Progress ferries but also hosted a succession of visitors who would arrive in a fresh Soyuz, stay for a week or so, and then leave in the older Soyuz so that a usable crew-return craft was always available.
The cost per additional usable questionnaire returned of issuing the reminder packs was £23.1 compared with £11.3 for the reminder postcards.
a Cost per usable survey returned b Additional cost of reminder This study examined the impact of several strategies on postal survey response rate.
To obtain a usable sequence return, the MseI restriction site must be a significant distance from the sequencing primer, preferably greater than 50 nucleotides before MseI recognizes the sequence TTAA.
