However uncovering usable drug combinations is expensive both financially and temporally.
Method of processing the stress loading histories in critical hotspot into a form usable in combination with hypotheses for fatigue damage calculation under multiaxial stress states is presented.
Writing code that is re-usable across many combinations of dimensionality, sample type and storage strategy is challenging and requires an appropriate abstraction layer.
VisArchive represents this contextual information using a combination of usable, visual, and interactive components to better support searching, browsing and exploring project archives.
80 out of a total 3840 cases (2.08%) had to be excluded because of errors during automated worm-transfer (either no worm or more than one worm per well), resulting in between 75 and 80 usable data points per combination of worm and bacterial strains.
In order to maximize usable returned sequence data, a combination of three primers were utilised separately for each clone: C.elegans RNAi F from the Source BioScience library, forward 5′ ggagaccggcagatctgata, and reverse 5′ ggcctcttcgctattacgc.
Effects for 134,511 usable SNP were estimated for all breed trait combinations; SNP with the largest absolute values for effects were selected (5,000 for Holsteins, 1,000 for Jerseys, and 500 each for Brown Swiss and Ayrshires for each trait).
Using the peptide sequencing framework described here, our approach explores all 2 k possible ion-type assignments for an MS spectrum with k usable dependent MS spectra and selects the combination of assignments resulting in the highest scoring peptide.
The combination of both methods provided a usable dictionary which was sufficient for the needs of our experiment.
The power of this technique was demonstrated when a usable human draft genome assembly was produced using a combination of differently sized short read jumping libraries (180 bp to 40 kb) with the ALLPATHS-LG assembler [ 10].
