Sentence examples for usa code from inspiring English sources

To obtain an image with enhanced grid points, a threshold was applied and binary erosion was performed, using in-house developed MATLAB (MathWorks Inc., Natick, MA, USA) code.

Using this assay, we screened a panel of 522 well-curated kinase inhibitors (GlaxoSmithKline, USA; code: PKIS2) for activity against H. contortus by measuring the inhibition of larval motility using an automated image analysis system.

Statistical analysis (SAS® 9.2, SAS Institute Inc., Cary, NC, USA) code was used to analyze DSR of nests of female greater sage-grouse (C. urophasianus) in the Wind River Basin in central Wyoming, USA.

Spectrally-rotated syllables (rotation frequency = 1.5 kHz) were created by applying a digital version of the algorithm introduced by Blesser [8], implemented in custom Matlab (The Mathworks, Natick, MA, USA) code, and applied to the recorded syllables.

The staining was then visualized using a streptavidin-biotin-peroxidase complex (StreptABComplex/HRP, Dako, Glostrup, DK, code K377) and a tyramide signal amplification (TSA -kit (NEN, Life Science ProducTSA -kitham, MA, USA, code NEN, Life Scienceere aProductsolloWalthame MAnUSAcodeer's recommeNEL700As.

Protein determination was performed with protein Assay Dye Reagent Concentrate (Bio-Rad, Hercules, California, USA; code: 500-0006).

For fractal dimension estimation based on structure function and variation methods, we developed custom MATLAB (MathWorks Inc., Natick, MA, USA) codes.

During each step, after a steady state was reached, the main hemodynamic and respiratory parameters were recorded and a breath-by-breath analysis of flow, airway pressures and EDi waves, was performed by using custom made Matlab (The Mathworks, Natick, USA) codes.

The Cerulean (kind gift from Dr. Piston, Vanderbilt University, USA) coding sequence was amplified using the following primer pairs: sense primer with a NotI site: 5'- CAGTCCTGCGGCCGCATGGTGAGCAAGGGCGAGGAGCTG -3' and antisense primer with a BamHI site: 5'- TCAGGATCCGAGAGTGATCCCGGCGGCGGTCACG AACTC -3'.

The experimental data [ 21] and MATLAB (Mathworks, USA) codes are provided as (Additional files 1, 2, 3, 4 and 5).

JS1 cells (mouse activated HSCs) were transfected with Addgene plasmid 20745 (Addgene, Cambridge, MA, USA) coding DN IRE1 α (K599A, dominant negative kinase mutant), generated by Dr. Fumihiko Urano, using Lipofectamine (Invitrogen).