Your English writing platform
Discover LudwigSuggestions(2)
Exact(21)
To eliminate alignment artefacts due to insertion/deletion positions, the lower strand reads were converted to the reverse complement sequence, i.e. keeping the same strandness as the upper strand reads, when aligned with the reference sequence.
As a competitor of SAF-1 binding, some binding reactions contained 50 pmol of a canonical SAF-binding double-stranded oligonucleotide having an upper strand sequence of 5′-CCCTTCCTCTCCACCC-3′.
When the result of roulette in GMB is like this picture, the rotatable fifth base (see arrow in this figure) of the upper strand of DNA will change A to C. By reference to the mutation table (Fig. 3), this DNA change will cause the shift of "size of the wings": the front wing will be smaller and the back wing will be bigger Fig. 3 Mutation table.
Two DNA primers were designed and utilized as follows: upper strand primer: 5' GTGTTCandGGCCGCTCCGGGCTATGAAATAGAAAAATGAATCCGTTGCCTGCGTTATC3', and lower strand primer: 5'CAGGATGGCGGCCGCCCATCTGGTATCACTTAAAGGTATTAAAAACCCCACAGATGCG3', which were synthesized by Shanghai Sangon Co. Ltd.
Taken together our results suggest that the upper strand or bottom strand cytosines (5'-GCAG-3'/3'-CGTC-5') were not the sites of methylation by HP0593 MTase.
The sequences for the LEF1 qPCR primers: Upper strand: 5'-TATGATTCCCGGTCCTCCTGGTC-3'; Lower strand: 5'-TGGCTCCTGCTCCTTTCTCTGTTC-3' For immunoprecipitations, cells were harvested by centrifugation and washed one time with DPBS on ice.
Similar(38)
Second, the end-polishing step was omitted, and modified A and B adapters were used as follows: adapter A-upper strand: 5'-CCATCTCATCCCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCAGT-3', adapter A-lower strand: 5'-CTGAGACAGGGAGGGAACAGATGG-3', adapter B-upper strand: 5'-BIO-TEG-CCTATCCCCTGTGTGCCTTGCCTATCCCCTGTTGCGTGTCTCAGT-3' and adapter B-lower strand: 5'-P-CTGAGACACGCAACAGGGGATAGGCAAGGCACACAGGGGATAGG-3'.
Double-stranded DNA substrates were prepared by mixing a 5 µM solution of a 5'-fluorescein-labelled oligonucleotide (upper-strand) with a 10 µM solution of an unlabelled oligomer (lower-strand), heating to 95°C for 5 minutes and slowly cooling to room temperature.
Primers and Probes are designated by the nucleotide position (relative to TBP GenBank Number X54993 and CCND1 GenBank Number X59798) corresponding to the 5′ position, followed by the letter U for upper (sense strand) or L for lower (antisense strand).
The stem of LTR32 reproduces the processed version of LTR34, that is a stem with the upper transferred strand lacking 3' GT (15 nucleotides) and the lower non transferred strand (17 nucleotides including the dangling 5'AC).
Reads above the line represent cDNAs prepared from mRNAs transcribed from the upper DNA strand in the rightward direction of the genome, and reads below the line represent mRNAs transcribed from the bottom DNA strand in the leftward direction of the genome.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com