Sentence examples for upper cutting from inspiring English sources

Use the uppercut and hold the punch button, joe should keep upper cutting Jet Black.

In addition, for the primary investigation into the size/shape distribution of biosynthesized GNPs, the boxplot was used with five-number summaries, i.e., the smallest observation, the lower quartile and the upper quartile cutting off the lowest and highest 25% of the data, respectively, the median which is the middle value of the data and the sample maximum [18].

Taylor relocated his touch, driving beautifully through mid-on and cover, and audaciously upper-cutting too.

Those famous pictures of a screaming Andrew Flintoff upper-cutting the air capture the heady essence of fight-back fever.

Baylor plans to teach level, line-drive swings, believing the Mets have been upper-cutting too many pitches, resulting in fly balls.

I landed a perfect counter attack, upper-cutting an irksome thug into the air before enabling the Batmobile's remote cannon as a brutal non-fatal combo finisher.

In other individuals the ribs extend all the way across the jaw, making both the upper and the cutting edges of the jaw clearly denticulate (noticeably toothed in outline).

The gene was amplified by PCR method using the following two primers with NheI and HindIII restriction sites: TATATAGCTAGCATGTCCACGACGG (upper primer, NheI cutting site as underlined); CGTCGCAAGCTTGAGCTACTTAAC (lower primer, HindIII cutting site as underlined).