Your English writing platform
Discover LudwigSuggestions(2)
Exact(1)
During the nomenclature process, the first letter in upper case was used to identify the genus name, the second letter in lower case (in a few cases the first 2 3 letters) was used to identify species name, after which the MPK and number of corresponding orthologs of Arabidopsis or Oryza sativa.
Similar(59)
R.F.C., in upper case, is a Rugby Football Club for a sports enthusiast.
Its upper case is supported only by columns and an undershelf.
Typing in ALL UPPER CASE is considered shouting, which is not good netiquette.
Applicants who type only in lower-case letters, or entirely in upper case, are less likely to repay loans, other factors being equal, says Douglas Merrill, founder of ZestFinance, an American online lender whose default rate is roughly 40% lower than that of a typical payday lender.
The performance of the proposed joint precoder designs is demonstrated by numerical simulations in Section 5. Finally, some conclusions are drawn in Section 6. Notation: A boldface upper case is used for a matrix, and a boldface lower case for a vector.
tsp4b for gfp fusion: FP gttctttttgcaggatcccatcgattcATGGCCGGCACAATGCATCTCC (upper case is tsp4b sequence, lower case is pCS2 vector sequence); RP— GCTCCTCGCCCTTGCTCACCATCAAGGGGTCCATGCCATGTTGTGTACTG (upper case under lined is gfp sequence, upper case is tsp4b sequence).
gfp for tsp4b fusion: FP GTACACAACATGGCATGGACCCCTTG ATGGTGAGCAAGGGCGAGGAGC (upper case is tsp4b sequence, upper case underlined is gfp sequence); RP ctagaggctcgagaggccttgaattc CTATAGGGCTGCAGAATCTAGAGGCTC (upper case under lined is gfp sequence, lower case is pCS2 vector sequence).
tsp4b for FLAG fusion: FP caagctacttgttctttttgcaggatcATGGCCGGCACAATGCATCTCCTC (upper case is tsp4b sequence, lower case is pCS2-3XFLAG vector sequence); RP cgtcatggtctttgtagtccatgtcCAAGGGGTCCATGCCATGTTG (upper case is tsp4b sequence, lower case is pCS2-3XFLAG vector sequence).
pCS2-3XFLAG for tsp4b fusion: FP CAACATGGCATGGACCCCTTGgacatggactacaaagaccatgacg (upper case is tsp4b sequence, lower case is pCS2-3XFLAG vector sequence); RP GAGGAGATGCATTGTGCCGGCCATgatcctgcaaaaagaacaagtagcttg (upper case is tsp4b sequence, lower case is pCS2-3XFLAG vector sequence).
The binary information of whether all characters within the candidate are upper case is used as a feature.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com