The speech in which the young Chartist agitator, Morley (in love with Sybil) describes "the Two Nations… between whom there is no intercourse and no sympathy" is brilliant, passionate and unforgettable, reaching its climax in that celebrated upper-case line: "THE RICH AND THE POOR".
pCS2 vector for tsp4b-gfp fusion: FP— GAGCCTCTAGATTCTGCAGCCCTATAGgaattcaaggcctctcgagcctctag (upper case under lined is gfp sequence, lower case is pCS2 vector sequence); RP GAGGAGATGCATTGTGCCGGCCATgaatcgatgggatcctgcaaaaagaacaag (upper case is tsp4b sequence, lower case is pCS2 vector sequence).
Days whose mean ± SD are followed by distinct upper case letters at the same line differ significantly (p < 0.0001).
The following primers were used for amplifying gfp from pEGFP-C1 vector; FP: CGAGAGCTACTCAATCGA TTTA ATGGTGAGCAAGGGCGAGG (upper case— tsp4b sequence, bold bridge to maintain translation frame, upper case under lined— gfp sequence); RP: ccttgaattcgaatcgatg gaattcCTATAGGGCTGCAGAATCTAGAGGCTCG (lower case— pCS2 sequence, bold EcoRI site, upper case— gfp sequence).
gfp for tsp4b fusion: FP GTACACAACATGGCATGGACCCCTTG ATGGTGAGCAAGGGCGAGGAGC (upper case is tsp4b sequence, upper case underlined is gfp sequence); RP ctagaggctcgagaggccttgaattc CTATAGGGCTGCAGAATCTAGAGGCTC (upper case under lined is gfp sequence, lower case is pCS2 vector sequence).
tsp4b for gfp fusion: FP gttctttttgcaggatcccatcgattcATGGCCGGCACAATGCATCTCC (upper case is tsp4b sequence, lower case is pCS2 vector sequence); RP— GCTCCTCGCCCTTGCTCACCATCAAGGGGTCCATGCCATGTTGTGTACTG (upper case under lined is gfp sequence, upper case is tsp4b sequence).
(The upper case appears on the rules page).
(The latter should thus be upper case "I", but older German uses upper case "J" for upper case "I").
Calligraphic upper case letters denote sets.
(Fixes to upper case letter in lead paragraph).
Convert all words to upper case.
