Your English writing platform
Discover LudwigExact(5)
Upon listing, the new company will be chaired by Qualcomm director Sir Donald Cruickshank, the former chairman of the London Stock Exchange.
Then in the 1990's, environmentalists brought lawsuits arguing that the Endangered Species Act requires mapping immediately upon listing of a species, whether or not the biologists have enough information.
Da et al. (2011b) demonstrated that the search intensity for companies with main products can predict their corporate profitability upon listing.
Upon listing the probes most highly correlated with probe pm6 from the 31846_at probe set (base sequence TCCTGGACTGAGAAAGGGGGTTCCT) it becomes apparent that there is a common theme: each probe contains a sequence of four or more consecutive Gs.
Express classification enables entities to create new positions or reclassify existing positions specified in an agreed upon listing of job classifications.
Similar(55)
This means that buyout talk will inevitably dwell upon listed businesses that are publicly struggling with strategic quandaries under the baleful eye of the shareholder community.
Initially, retrospective fee assessments would be modelled upon listed factors (Table 1).
Review the BI content specifications to create a revised and agreed-upon list of BI application deliverables.
There is no agreed-upon list of the financial products that have caused problems for yield-chasing investors, but regulators say certain ones come up particularly often.
At issue is who should determine what additional documents are acceptable forms of identification -- beyond those that lawmakers had named in their agreed-upon list -- when a voter goes to the polls.
While there's no complete and universally agreed-upon list of everything that makes fifth-generation aircraft legit 5th gen, there is one inescapable requirement: that the plane be designed from the ground up as a stealth aircraft.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com