Original universal slopes method, modified universal slopes method, Mitchell's method, Bäumel and Seeger's method, and Ong's method have been used for predicting the high temperature low-cycle fatigue performance.
In an attempt to alleviate this problem, Universal has modified the restraint system on some of the seats to accommodate larger guests.
The 1,152 clones were rearrayed into 96 well plates (CHORI, Children's Hospital Oakland Research Institute) and both ends of each clone were sequenced (Macrogen Inc., Seoul, Korea) using the universal T7 primer and the modified universal SP6 primer (ATTTAGGTGACACTATAGAAGG) for PCR amplifications at the forward and reverse ends, respectively.
The modified universal reaction model (MURM) is derived for overcoming the above limitation.
However, the modified universal slope method and the modified Diercks equation provide reasonably good predictions in these braze clad aluminium alloys.
The enzymatic activity of protease was determined using the modified universal procedure described by Sigma-Aldrich with casein as a substrate (Sigma-Aldrich 2013).
Simultaneously, a high-pressure gas liquid equilibrium model was proposed based on modified universal functional activity coefficient (UNIFAC) model, Soave Redlich Kwong (SRK) equation of state and modified Huron Vidal second-order (MHV2) mixing rule.
The original and modified universal slope methods, the uniform material law, and the modified Diercks equation have been applied to the low cycle fatigue life prediction in the braze clad AlMn1.0Mg0.5 alloys.
The global performance of the binary azeotropic mixtures was verified by means of calculations of the vapor liquid and liquid liquid equilibrium using modified universal functional activity coefficient (UNIFAC) method as a thermodynamic method.
The study has been focused on the implementation of a modified Universal Soil Loss Equation (USLE) model at three time points (1960 , 1990 2010) with the objective to evaluate the contribution of each component to model's performance and model outcomes' reliability.
