Sentence examples for universal interference from inspiring English sources

Exact(1)

Additive noise is omitted in the process of deducing the theoretical expression for the CIR, and the sequence S k−d) is defined to be the universal interference coefficient as begin{array}{*{20}l} S k-d)= left{ begin{array}{ccl} {S k-dimeprime}}_{i}(k-d) & qquad{d!in {A}_{i1}, {A}_{i3}} {S}_{i}(k-d) & {{d!in {A}_{i2}}} end{array}right.

Similar(59)

BADLY constructed houses, feckless owners, buyers with impenetrable personal finances, an untested legal environment, crooked and incompetent banks, and almost universal political interference in the economy.

Figure 1 describes a universal downlink interference model in heterogeneous network, where the macro BS represents the macro base station in the network, the MUE represents the user belonging to macro BS, the pico BS indicates the base station in pico cell, and PUS represents the user belonging to pico BS.

Production proceeded with virtually no input or interference from Universal.

Working with universal primers implies that interference from other bacteria is to be expected when starting from clinical samples [ 29], especially when mycoplasmas are not abundantly present.

U87MG cells were suspended in 100 µL of solution T (Amaxa) and nucleofected either with 300 nmol/L of non-targeting negative-control human small interference RNA (Negative Universal Control siRNA, Invitrogen) or 300 nmol/L human p53 siRNA (TP53 UHsiRNA7 sInvitrogentrogen) with an Amaxa nucleofector device (protocol X001; Amaxa Biosystems, Lonza).

Focusing on the universal frequency reuse scheme, inter-cell interference is a major impairment that limits the system throughput[3].

Moreover, the siRNA branch of eukaryotic RNA interference, which is nearly universal among eukaryotes, also encompasses a substantial heritable component, albeit in this case via the epigenetic route [ 37, 47- 49].

Colón defeated Ramon with his Back Stabber finisher, in a match that included interference by the then-Universal Heavyweight Champion Apolo.

The licence fee is designed to make the BBC independent of the cycle of annual government spending decisions and hence political interference, while sustaining it as a universal public service.

We procured siRNA against the GLI1 gene from Stealth™ (Invitrogen, USA) GLI1 RNAi: GCACAUACCUGCUUCGGGCAAGAUAU (GLI-HSS104170) and AUAUCUUGCCCGAAGCAGGUAGUGC (GLI-HSS104170), along with a universal negative siRNA to control for non-specific interference by the siRNA.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: