Sentence examples for unique segments from inspiring English sources

Taken from "Hurricane Attitudes of Coastal Connecticut Residents: A Segmentation Analysis". The audience analysis resulted in five unique segments: 1) the First Out; 2) the Constrained; 3) the Optimists; 4) the Reluctant; and 5) the Diehards.

"In just over a year, James has made a very big mark on US late-night television with a critically acclaimed show that features the biggest names in entertainment and unique segments that quickly become digital sensations," said Armando Nuñez, chief executive of CBS global distribution group".

Five oligonucleotide probes complementary to unique segments of the sequences were end labeled with 32P and hybridized on a nylon filter to the immobilized rRNA of each clostridium.

To confirm that the putative IS element is a single copy and does not represent a segment flanked by two copies PCR was performed with primers that hybridise in the unique segments on either side (5' –TCCCTTGTGCTAGTGTCATAG -3' and 5'-AGGCTTGAGTCAGATTAAGTCT-3').

Recent studies suggest that CAM no longer is a phenomenon restricted to unique segments enjoying high family income [ 39].

As clearly revealed in CodaChrome heat maps, these prophages are often the most unique segments of a genome.

This paper proves that for any member of the family, a unique segment of that spiral can be found that matches given two-point G1 Hermite data.

Operating managers were empowered to develop unique business models and launch derivative products by themselves to best serve each unique segment; and in the process, disrupted and competed with one another.

In the first module, GUSP (Generation of Unique Segment Pairs), we select a set of (n, r) unique segment pairs, which is defined as the segment set that satisfies the following conditions: (1) each segment length is n nucleotides, (2) all intended pairs of segments are in perfect match, and (3) the aberrant contiguous matching between any other segments is r bases less than the maximum.

But if you want to see a unique segment of that evolution, look to the Wii U.

Since QTRMA has its unique segment request scheme, we did not employ AR for it.