Sentence examples for unique segment from inspiring English sources

Exact(20)

Since QTRMA has its unique segment request scheme, we did not employ AR for it.

But if you want to see a unique segment of that evolution, look to the Wii U.

This paper proves that for any member of the family, a unique segment of that spiral can be found that matches given two-point G1 Hermite data.

In the first module, GUSP (Generation of Unique Segment Pairs), we select a set of (n, r) unique segment pairs, which is defined as the segment set that satisfies the following conditions: (1) each segment length is n nucleotides, (2) all intended pairs of segments are in perfect match, and (3) the aberrant contiguous matching between any other segments is r bases less than the maximum.

Notice that our model considers the left and the right parts of the hip and the torso as a unique limb, and therefore we require a unique segment per each.

As indicated earlier, given varying responses from consumers, we believe that a segmentation of consumers or the general public [31] will be helpful in garnering a deeper understanding of how different the risk and opportunity perceptions are for each unique segment in the general population.

Show more...

Similar(40)

"In just over a year, James has made a very big mark on US late-night television with a critically acclaimed show that features the biggest names in entertainment and unique segments that quickly become digital sensations," said Armando Nuñez, chief executive of CBS global distribution group".

To confirm that the putative IS element is a single copy and does not represent a segment flanked by two copies PCR was performed with primers that hybridise in the unique segments on either side (5' –TCCCTTGTGCTAGTGTCATAG -3' and 5'-AGGCTTGAGTCAGATTAAGTCT-3').

As clearly revealed in CodaChrome heat maps, these prophages are often the most unique segments of a genome.

Recent studies suggest that CAM no longer is a phenomenon restricted to unique segments enjoying high family income [ 39].

Unique peptides of query proteins, 13 hRNaseA family members, were identified employing Reinforced Merging for Unique Segments ReMUS system (ReMUS) (http://140.121.196.30/remus.asp) [ 42].

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: