Sentence examples for underlining in the from inspiring English sources

Earthquakes have sometimes acted to bring peace out of horror, underlining in the most graphic way the impermanence not just of human territorial divisions but of the earth itself.

Table 2 Sequences of the primers used in this study Primer Sequence (5′ 3′) Restriction sitea bktB-FwEcoRI CCGGAATTCAAGGAGGAATAAATGACGCGTGAAGTGGTAGTGG EcoRI bktB-RvXbaI TGCTCTAGAGCTCAGATACGCTCGAAGATGGCG XbaI pct-FwBamHI CGCGGATCCAATGCGCAAGGTGGAGATTATC BamHI pct-RvEcoRI CCGGAATTCTCACTTCTTCAGGCCCATCGG EcoRI aIndicated by underlining in the primer sequence.

Input enhancement (IE), the most unobtrusive of all form-focused techniques (e.g., Doughty & Williams, 1998), involves typographical enhancement to draw the learners' attention to the form by font manipulation (e.g., coloring, highlighting, underlining) in the text (Long & Robinson, 1998; Sharwood-Smith, 1993).

Pamela then repeats her question, this time stressing the word "go", marked by underlining in the transcript (line 11).

At line 71 "but" is used for a third time to signal continuation, however here it also appears to create contrast when followed by the phrase " two hands" (stress on the word "two" is indicated by underlining in the transcript).

Hilfenhaus's precision was underlined in the second innings.

The passages in italics were underlined in the original.

In fact, the clause surrendering your privacy is underlined in the "Big Brother" rules.

True, this principle was underlined in the Tripartite Agreement of 1947, when India gained independence.

Novello's importance is underlined in the credits, in which his name is spelled in huge capitals.

But the depth of die-hard partisanship in these hills was only underlined in the voting last Tuesday.