Sentence examples for underlined was from inspiring English sources

An oligonucleotide probe complementary to the AU5 tag coding sequence and its flanking region (au5hyb, GAATTCTCACTTGAGGTAGAAATCGGTAGGCGGGGTGAGG, AU5 tag coding sequence is underlined) was end-labeled using [γ-32P] ATP and T4 polynucleotide kinase.

To change the amino acid K277 to A227 (K227A), the oligos used were 5'-GCTGCCCTG CCACAGAACGCAGCGCtopAAATCAAACGTCCGGTG3' (toligoigo) and 5'-CACCGGACGTTTGATTTTTAGCGCTGCGTTCTGTGGCAGGGCA- GC-3' (bottom oligo); a restriction site, AfeI (underlined), was created to screen the mutants.

In order to determine, whether a C or A was the target base of methylation in 5'-GCAG-3'/3'-CGTC-5' sequence, duplex 7 was used in which bottom strand 3'-cytosine (shown in bold and underlined) was first analyzed for methylation.

A polymorphic nucleotide change at bp 6748 in FJ439133 (underlined) was used to preferentially amplify the 4A subtelomeric region.

The A in bold and underlined was changed from a T to an A to change a serine to a threonine.

Methylation of the evolutionarily conserved glutamate at position E157 (underlined) was detected in this assay system, and importantly, this residue is within the nuclear localization signal (NLS) [ 24].

Among the collection of philosophical epigrams, in special brackets and underlined, is a quote from Rilke: "Works of art are of an intimate loneliness.

TGA and TAA (underlined) are the stop codons for MT-1 and MT-II, respectively.

All primers used in this study and reverse-complement nucleotides with underlined were showed in Table 1.

A Sal I restriction site in 5' (underlined) and a PshAI restriction site in 3' (underlined) were added in the forward and the reverse primer, respectively.

Loci underlined are located on the N strand.