Sentence examples for underlined using from inspiring English sources

In a parallel approach, bgl1 was amplified with primers Bgl1-LguI-f (5′-CAGCTCTTCCTCAGTAAAGTTCCCTAAAGGGTTCATG, LguI-restriction site is underlined) and Bgl1-Eco81I-r (5′-GTCCTGAGGAAGTAAGAACGTTTGGAAATTTACTGTATTC, Eco81I-site is underlined) using pQE-80L::bgl1 as template (Schröder et al. 2014).

The lowest excitation energies and the maximal absorption and emission wavelength (λmax ABS, λmax EM) are also underlined using the time-dependent density functional theory (TDDFT) method.

We designed eight locus-specific oligo-primer (20 nt) pairs based on the nucleotide substitutions between exon sequences of the Pacific bluefin tuna (Fig. 3, underlined), using which fish species shown in Table 1 were subjected to PCR amplification under abovementioned condition.

The coding region of AtHb1 (At2g16060) was PCR-amplified (F- GGATCCGAGGTTGTGAAATATTATGGAG and R- GGATCCTAGGATTTTGGAATGCACACTA BamHI sites underlined) using a full-length AtHb1 clone (kindly provided by P. Geigenberger, LMU Munich, Germany).

PCR amplification of exon 2 of MATN3, which encoded the entire A-domain, was performed using primers MATN3ex2F (5′- ggcccagccggcctgcaagagcagacccttggac-3′, Sfi I restriction site underlined) and MATN3ex2R (5′- gcggccgcacagaaggtttcctggaatct-3′, Not I restriction site underlined) using a standard protocol.

The gene encoding FNR SynPcc7942_0978 was amplified with the forward primer (5′-CGCGGCCATATGATGTTGAATGCGAGTGTG-3′, the NdeI I restriction site underlined) and the reverse primer (5′-CATTCGCTCGAGGGCTGAACTAGTAGGTTT-3′, the XhoI restriction site underlined) using genomic DNA as a template.

All of your due dates should be marked, highlighted or underlined; use anything that draws your attention.

The IOC-MC guidelines also underline use of FEV1 as a marker of airway narrowing [ 8] given that use of PEFR may lead to misclassification [ 11] and as such is no longer recommended in guidelines or accepted by WADA.

Note that the underline used at the right end of code lines is to extend the line to the next line down, so the next line is in fact part of the entire sub-procedure or expression.

Briefly, PCR primers containing desired mutations (E235A, 5′-CTCATTATCCAG CAAGACTAGGAAAAGCAC-3′ and K267A, 5′-GTTCATCAAAAACTAG CGCTTCACGGGTC-3′, changes underlined) were used to generate a DNA fragment (126 bp) using plasmid YEplac181- PDR16 as template.

Finally, it can be underlined that, use of ANN for simulation of shear development in granular soils is promising, if the inputs and output parameters are correctly determined.