Sentence examples for underlined used from inspiring English sources

Exact(1)

The κB-site probe (5'-TCGAGAGGTCGGGGAATCCCCCCCCG-3'; κB site underlined) used for the EMSAs is from the upstream region of the Nv-IκB gene [6].

Similar(59)

In a parallel approach, bgl1 was amplified with primers Bgl1-LguI-f (5′-CAGCTCTTCCTCAGTAAAGTTCCCTAAAGGGTTCATG, LguI-restriction site is underlined) and Bgl1-Eco81I-r (5′-GTCCTGAGGAAGTAAGAACGTTTGGAAATTTACTGTATTC, Eco81I-site is underlined) using pQE-80L::bgl1 as template (Schröder et al. 2014).

The lowest excitation energies and the maximal absorption and emission wavelength (λmax ABS, λmax EM) are also underlined using the time-dependent density functional theory (TDDFT) method.

We designed eight locus-specific oligo-primer (20 nt) pairs based on the nucleotide substitutions between exon sequences of the Pacific bluefin tuna (Fig. 3, underlined), using which fish species shown in Table 1 were subjected to PCR amplification under abovementioned condition.

PCR amplification of exon 2 of MATN3, which encoded the entire A-domain, was performed using primers MATN3ex2F (5′- ggcccagccggcctgcaagagcagacccttggac-3′, Sfi I restriction site underlined) and MATN3ex2R (5′- gcggccgcacagaaggtttcctggaatct-3′, Not I restriction site underlined) using a standard protocol.

PCR amplification to remove the stop codon was then performed using M3XbaF (5′-ctttcc tctagattccaggaa-3′, Xba I restriction site underlined) and M3R (5′- aagcttacgatgtatttgtccat attc-3′, Hind III restriction site underlined) using a standard protocol with P fu DNA polymerase.

The gene encoding FNR SynPcc7942_0978 was amplified with the forward primer (5′-CGCGGCCATATGATGTTGAATGCGAGTGTG-3′, the NdeI I restriction site underlined) and the reverse primer (5′-CATTCGCTCGAGGGCTGAACTAGTAGGTTT-3′, the XhoI restriction site underlined) using genomic DNA as a template.

The gene encoding Fd SynPcc7942_1499 was amplified with the forward primer (5′-GCTCAGCATATGATGGCAACCTACAAGG-3′, the NdeI I restriction site underlined) and the reverse primer (5′-GGCTCGCTCGAGTTAGTAGAGGTCTTCTTC-3′, the XhoI restriction site underlined) using genomic DNA as a template.

The coding region of AtHb1 (At2g16060) was PCR-amplified (F- GGATCCGAGGTTGTGAAATATTATGGAG and R- GGATCCTAGGATTTTGGAATGCACACTA BamHI sites underlined) using a full-length AtHb1 clone (kindly provided by P. Geigenberger, LMU Munich, Germany).

aureus strain 8325-4 genomic DNA template with primers for MW1329 (forward, 5′-TATTG AATTCAAAGAAGGAACGTTTAAATGCCT-3′; reverse, 5′-TTTATAC GGATCCAAAAATGGGATGAAATATATTTTCC-3′), with the restriction site underlined, using the Expand High Fidelity PCR System, according to the manufacturer's instructions (Roche Diagnostics GmbH).

All of your due dates should be marked, highlighted or underlined; use anything that draws your attention.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: