In a parallel approach, bgl1 was amplified with primers Bgl1-LguI-f (5′-CAGCTCTTCCTCAGTAAAGTTCCCTAAAGGGTTCATG, LguI-restriction site is underlined) and Bgl1-Eco81I-r (5′-GTCCTGAGGAAGTAAGAACGTTTGGAAATTTACTGTATTC, Eco81I-site is underlined) using pQE-80L::bgl1 as template (Schröder et al. 2014).
The lowest excitation energies and the maximal absorption and emission wavelength (λmax ABS, λmax EM) are also underlined using the time-dependent density functional theory (TDDFT) method.
We designed eight locus-specific oligo-primer (20 nt) pairs based on the nucleotide substitutions between exon sequences of the Pacific bluefin tuna (Fig. 3, underlined), using which fish species shown in Table 1 were subjected to PCR amplification under abovementioned condition.
PCR amplification of exon 2 of MATN3, which encoded the entire A-domain, was performed using primers MATN3ex2F (5′- ggcccagccggcctgcaagagcagacccttggac-3′, Sfi I restriction site underlined) and MATN3ex2R (5′- gcggccgcacagaaggtttcctggaatct-3′, Not I restriction site underlined) using a standard protocol.
PCR amplification to remove the stop codon was then performed using M3XbaF (5′-ctttcc tctagattccaggaa-3′, Xba I restriction site underlined) and M3R (5′- aagcttacgatgtatttgtccat attc-3′, Hind III restriction site underlined) using a standard protocol with P fu DNA polymerase.
The gene encoding FNR SynPcc7942_0978 was amplified with the forward primer (5′-CGCGGCCATATGATGTTGAATGCGAGTGTG-3′, the NdeI I restriction site underlined) and the reverse primer (5′-CATTCGCTCGAGGGCTGAACTAGTAGGTTT-3′, the XhoI restriction site underlined) using genomic DNA as a template.
The gene encoding Fd SynPcc7942_1499 was amplified with the forward primer (5′-GCTCAGCATATGATGGCAACCTACAAGG-3′, the NdeI I restriction site underlined) and the reverse primer (5′-GGCTCGCTCGAGTTAGTAGAGGTCTTCTTC-3′, the XhoI restriction site underlined) using genomic DNA as a template.
The coding region of AtHb1 (At2g16060) was PCR-amplified (F- GGATCCGAGGTTGTGAAATATTATGGAG and R- GGATCCTAGGATTTTGGAATGCACACTA BamHI sites underlined) using a full-length AtHb1 clone (kindly provided by P. Geigenberger, LMU Munich, Germany).
aureus strain 8325-4 genomic DNA template with primers for MW1329 (forward, 5′-TATTG AATTCAAAGAAGGAACGTTTAAATGCCT-3′; reverse, 5′-TTTATAC GGATCCAAAAATGGGATGAAATATATTTTCC-3′), with the restriction site underlined, using the Expand High Fidelity PCR System, according to the manufacturer's instructions (Roche Diagnostics GmbH).
The IOC-MC guidelines also underline use of FEV1 as a marker of airway narrowing [ 8] given that use of PEFR may lead to misclassification [ 11] and as such is no longer recommended in guidelines or accepted by WADA.
