Next, PCR was performed using the pUC119-CauloGA as a template, with the forward primer 2, 5′-GCGAATTC GGCGCCTACGACCTGGGCCTATTCG-3′, and the reverse primer 2, 5′-CGGGATCC CTAGCGCGCGTACCGCGCCTTTACGGG-3′ (the EcoRI and BamHI sites, respectively, are underlined), to remove a putative signal peptide sequence that was predicted by SignalP (http://www.cbs.dtu.dk/services/SignalP/).dtu.dk/services/SignalP/
These data underline the urgency to remove the exemption of nutrition labelling for food products intended solely for use in restaurants and foodservice operations.
Peter Siddle then underlined his qualities as he ran in with real purpose to remove Joe Root and Tim Bresnan, and if Australia had taken either of their chances to dismiss Cook, England could have been in trouble.
Mackay underlined that fact in a tweet saying it was not his decision to remove Haggerty.
In the welter of acrimony that ensued, Quinlan took care to remove his beloved wine collection from the cellars at Claridge's, underlining his effective detachment from the business.
An amendment drafted by the party last autumn proposes to remove the ambiguities surrounding the role of the armed forces and to underline Japan's right to take part in international operations outside the country's borders.
Moreover, this underlines the complex regulation of Atoh1 by Hes1 and suggests that other factors are present to remove the repression of Atoh1 expression following RBP deletion.
PCR amplification to remove the stop codon was then performed using M3XbaF (5′-ctttcc tctagattccaggaa-3′, Xba I restriction site underlined) and M3R (5′- aagcttacgatgtatttgtccat attc-3′, Hind III restriction site underlined) using a standard protocol with P fu DNA polymerase.
She underlines the word 'choose' since, although she is now cancer-free, it was never the case of choosing whether to remove her breasts or not at the ages of 37 and 39.
Finally to remove our conditions ({underline{u}}, {bar{u}} in C^2 {bar{Omega }})), we may replace (Omega ) by a parallel approximating domain (Omega _ epsilon = { xin Omega | mathrm{dist} x,partial Omega ) > epsilon }) for (epsilon > 0) sufficiently small, with G extended to (partial Omega _epsilon times {mathbb {R}}times {mathbb {R}}^n) to be constant along normals to (partial Omega ).
To remove the unnecessary DNA backbone, the primer pair FP-Kan-KpnI-AvrII (5′- GCTCCCGGTACC GCCAGGCGGCCTAGG TTTCAAAATCGG -3′) containing Kpn I and Avr II (underlined), and RP-pGEMT-ORI-KpnI (5′- GCCTCACTGATTAAGCATTGGTACC TGTCAGACC -3′) containing Kpn I, (underlined) was used to amplify the 2,916 bp fragment of pGEM-pSa-Kan that included the Ori-pSa-Kan R sequence by PCR.
