Your English writing platform
Discover LudwigSimilar(60)
Primers SLR1-11 (5′-GGAATTC CATATGAAGCGCGAGTACCAAGAAG-3′, added NdeI site underlined) and SLR1-12 (5′-CG GAATTCCGCCGCGGCGACGCGCCATGCC-3′, added EcoRI site uNdeIlined) were usiteto amplify the SLR1 coding region, which was sunderlinedinto vector pGBKT7 (Clontech, USand
To remove the unnecessary DNA backbone, the primer pair FP-Kan-KpnI-AvrII (5′- GCTCCCGGTACC GCCAGGCGGCCTAGG TTTCAAAATCGG -3′) containing Kpn I and Avr II (underlined), and RP-pGEMT-ORI-KpnI (5′- GCCTCACTGATTAAGCATTGGTACC TGTCAGACC -3′) containing Kpn I, (underlined) was used to amplify the 2,916 bp fragment of pGEM-pSa-Kan that included the Ori-pSa-Kan R sequence by PCR.
Primers EL1-11 (5′-GATGCCAGAGTTGCGGGGTGGT-3′) and EL1-12 (5′-CCG CTCGAGGCATACGGTCCGGCCGTAGCAG-3′, added XhoI site underlined) were used to amplify the EL1 coding region, which was sub-cloned into vector pGADT7 (Clontech, USA).
Human TPβ cDNA was amplified by PCR with HindIII and EcoRI restriction sites using the following primers CGAAGCTTATGTGGCCCAACGGCAGT and CGCAGTGAATTCCGCCTGTAATCCC AG (restriction sites underlined, 5' to 3').
A sense primer with the BspE1 site (underlined) 5'-AGTCTCCGGAGGAGGTGGAAGCAAGGGCGAGGAGCTG-3' and an anti sense primer with a BglII site (underlined) 5'-AGTCAGATCTTCCACCTCCCTTGTACAGCTCGTCCATGCC-3' were used to amplify Cerulean from the Cerulean C1 vector.
The primers FP-TuMV7804-Kpn FP-TuMV7804-Kpn FP-TuMV7804-KpnAACAAC -3′) contaIning Kpn I (underlined), and MTuCP885′ (5′- GGAAAGGTACCTCGTGGATGATTTCAACAACused to amplify the region between the NIb and CP genes from p35S-TuMV-YcontainingS-TuMV-GFP, respectively.
Primers used to amplify target-gene fragments flanked by attL1 and attL2 sequences (underlined) for each gene, with expected amplicon size in base pairs (bp) and annealing temperature adopted.
To amplify the coding sequence of CsLEA11, the primers 5′-aaaaGGATCCATGGCGAATGTACGCGATGAG-3′ (BamH I restriction site underlined) and 5′-aaaaAAGCTTATGATGGTGGCCAGGTAATTTC-3′ (Hind III restriction site underlined) were designed.
All plasmids used in this work are listed in Table 1, and the primers used to amplify the ' AcTesA gene are listed in Table 2. Underlines indicate restriction enzyme sites or mutagenized codons.
To amplify the full-length coding region of the Nv-NF-κB cDNAs, forward (5'CGGAATTCCGTCCTAGTGGTGTATCAAGTGCAG3; EcoRI site underlined') and reverse (5'TCGGTCGACCGCGAAAACCCAATTGGAG3'; SalI site) primers were used in the PCR, and the cDNAs were subcloned into the corresponding sites of pcDNA3.1.
These primers were designed to amplify the entire coding sequence, excluding the 3' termination codon and including restriction sites EcoRI and XbaI (underlined).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com