Sentence examples for underlined the same from inspiring English sources

Exact(1)

It should be noted that this designation is not — and 'not' is underlined the same as the city's heritage tree designation.

Similar(59)

Both representations underline the same tendencies.

Finally, the content of the variables which belonged into the same factor had to underline the same construct, so that it would make sense their all together consisting a factor under a new name.

And when we showed Walt our notes and played the song sketches, he pulled out his book, and he'd underlined the very same chapters".

A landmark trial on postoperative radiation treatment by Aalders et al (1980) underlined the importance of the same set of features: grade, depth of myometrial invasion and LVSI, as prognostic factors for disease recurrence.

The rot gene was PCR-amplified from 8325-4 chromosomal DNA using the primers KpnI-rotF (5'-TTACCATGGTACC ATTGGGAGATGTTTAGCATG) and SacI-rotR (5'-ACATCAGAGCTC CCAACGTAATCATGCTCCAT) which, except for the added restriction sites (underlined), are the same primers that J. Oscarsson used to clone rot in pWA163 [11].

Moreover, as underlined by the same authors, no control study, with vitamin C alone, were performed.

57 The need for a more complete assessment to detect geriatric problems in older cancer patients admitted to geriatric wards was underlined by the same authors.

There is a growing body of evidence that these two laterality disorders, SIT and HS, are actually part of a phenotypic continuum, underlined by the same genetic defects.

The severity of the agricultural crisis was underlined at the same news conference by John Ging, operations director for the UN's Office for the Coordination of Humanitarian Affairs.

The angled forehand across court in the same game underlined the theory.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: