Sentence examples for underlined that was from inspiring English sources

(CTG 400 tracts were cloned into an SfiI site located within a linker sequence (TGGCCACGCGGGCCATTTAAATGGCCATTAGGGCC: SfiI sites are underlined) that was inserted between the termination codon of the β-galactosidase gene and the bovine growth hormone polyadenylation (BGH-PolyA) sequence.

He recalled being shown a copy of his statement with some areas underlined that were to be "taken out".

It is to be underlined that these are by no means problems that have not be dealt with before.

It should be underlined that exosomes are also detected in normal subjects, being secreted also by normal cells of different organs, including blood cells.

It should be underlined that there are modest improvements in VA in comparison with the natural course of the disease, which is a gradual deterioration of VA.

A statement by Banksy read out at the event underlined that it was not intended to be a celebration.

But it should be underlined that orthorexia is a disorder of the mind more than anything else.

In this regard, it has to be underlined that there is no reliable evidence that a reduction in catecholamine requirements may lead to an improved outcome.

In fact, it must be underlined that LCLs are not the ideal model to investigate mitochondrial functions, due to the small cytoplasmic percentage within cells.

(Underlining that is a sponsored name, the Bank of America Winter Village at Bryant Park).

Boucher underlined that Burns was keenly interested in the Strategic Dialogue.