The newly added topical props, music and references (to iPods, BlackBerries, Web sites, "The Da Vinci Code") only confirm the feeling that "subUrbia" is set in some faceless Angstville, U.S.A., a sense further underlined by Richard Hoover's sterile set, centered on a detailed replica of a 7-Eleven-type convenience store.
Mutation of the wildtype Tensin3 cDNA in pcDNA3 vector was performed by QuikChange site-directed mutagenesis (Stratagene, Amsterdam, The Netherlands) according to the manufacturer's instructions, using the following primers (switched nucleotide underlined): 5'-CATGTGGTCGTCATTCACAGCAGGGGCGGGAAAGGAC-3' (sense) and 5'-GTCCTTTCCCGCCCCTGCTGTGAATGACGACCACATG-3' (antisense).
GFP-EHD1 ΔEH 1-4388) was generated using 5′-GCCTCGAGATGTTCAGCTGGGTCAGC-3′ (sense primer, XhoI site is underlined) and GCGAATTCTCACTCCACGTCGTCGATGC (antisense primer, EcoRI site is underlined).
Used probes (with SNP underlined) were 5'-VIC-CACGCAC CAAGTCA (anti-sense) and 5'-FAM-AGCCAC GAAGTCA (anti-sense).
TH2-CP was amplified by PCR using the sense primer 5′-CATATGTCCCGAAAACGCCTGGCAGGGC-3′ (the underlined region represents the NdeI site and includes the initiation codon) and the antisense primer 5′-AAGCTTCAGTCGGCCGACCG-3′ (the underlined region represents the HindIII site and is adjacent to the stop codon).
Note: ⋆ Only sense strands for oligonucleotides used in EMSA were shown; underlined parts were the putative binding sites, and mutated nucleotides were denoted as the lowercase letters.
A cDNA fragment encoding the LERP ectodomain (amino acids 42 781) was amplified using the primers 5′-AA TCTAGAGACGCAGCCAATCAGC-3′ (sense) and 5′-AA TCTAGATCAGAGGGAAAGGAACTCGC-3′ (antisense), cleaved with XbaI at the underlined sites and then ligated into pVTBacHis-FLAG.
Mutagenesis of Pro was performed using synthetic double-stranded primers (sense primer, 5′-GCTAATTATGGGTTGCTGC NNNGGAGGAACTGGCTCC-3′; and antisense primer, 5′-GGAGCCAGTTCCTCC NNNGCAGCAACCCATAATTAGC-3′; where the underlined portions represent the Pro codon, and N indicates a randomized nucleotide).
The vector was prepared by PCR amplification of PL458 with two oligonucleotides that only excluded the sequence coding for PNP1 20 using the sense primer 5′ ATG GACAGCGATGACCGCGTG 3′ (with Met-MTGase start codon underlined) and the antisense primer 5′ GGA AGAATTCGTAATCATGGTCATAGCTG 3′ (where the first underlined codon is the complementary codon for the last aminoacid of LacZ1 8 fragment).
Indeed, we found that the presence of a C in the canonical C AGCTG site (with C11 underlined) of the gene was predicted to lead to a loss of AP-4 (transcriptional activator) binding on the sense strand and to loss of ZNF238 (transcriptional repressor) binding on the antisense strand, both of which would be expected to lower steady-state ESR1 mRNA (40, 41).
Cut underlined means I really want you to cut it.
