Sentence examples for underlined represents from inspiring English sources

ATG (underlined) represents the start codon.

LINfs3 (UGA CUA, stop codon underlined) represents the global minimum of regression error (filled circle).

The underlined represents the Flag tag sequence.

The Seq_id with underline represents wild soybean lines (G. soja ).

Underline represents the reference type closest to individual U3 sequences examined.

Bold italic shows values which are statistically significant for both of KST and FST, with positive values of G'ST and D. Underline represents statistical significant KST and FST with more than 0.05 of G 'ST and D. Boldcharacters indicate conservation and management units which have more than 10 samples.

The primer used were 5'-CATCATaccggt ATGGACTACAAAGACGATGACGATAAA ATGAATTTGCAACTGGTT TCCTGGATTGGA-3' (small letters represent a restriction site for AgeI and underlined letters represent FLAG sequence) and ATGATG ACTAGTTCATTTTCCCTCATACTTCGGATTGACCAC (bold letters represent a restriction site for SpeI).

Underlines represent additional amino acids coupled onto the tau peptides.

The participants received feedback in the form of either an asterisk, representing a correct keystroke, or an underline, representing an incorrect keystroke when typing each key.

The consensus sequence between position −5 and position 5 is "A(G/C A(G/C N- NN (A/T) NN-N(C/G T(C/G)T" (the nucleotides in the middle with underline represent TSD sequences).

The nucleotide dispensation sequences for the G638A and A667G SNPs were G TC AGCAC and ACA TC AGAG, respectively (underlined nucleotides representing the negative control and bold nucleotides representing the polymorphic sites).