Sentence examples for underlined is from inspiring English sources

The 4-AS1 promoter (p-4AS1; dashed underlined) is followed by the Wheat major chlorophyll a/b binding protein gene (wtCAB; wave underlined) and Rice Actin Intron (rAct; dotted underlined) to regulate the Cry3Bb1 gene (double underlined).

Among the collection of philosophical epigrams, in special brackets and underlined, is a quote from Rilke: "Works of art are of an intimate loneliness.

Residue R213 (underlined) is located in this stretch of amino acids.

We have the Schengen acquis, that, as Mr Pirker quite rightly underlined, is implemented very differently in the various States.

The 21 bp, underlined and bolded, is the sequence of the primer 031704-RP; and the 19 bp, underlined, is the reverse complement sequence of the primer LBb1.3.

The sequences of the primers were: 5'- TAGTGAATTT TTGGCTCTGA TGTCTCGTCA ACTCAAATCA GGTTCAGGT AGTAAAGGAG AAGAACTTTT CandG-3' ATACTTTAAAAGCTTCTAGTGCTTCTAGTTCTTGTTTGTT CAGAGTCATT TCCAGATCC TTCGAAACCA CTGTTGTGCA G-3' in which bold sequence is homologous to the intein cassette and underlined is homologous to the CMD1 site of insertion.

TGA and TAA (underlined) are the stop codons for MT-1 and MT-II, respectively.

All primers used in this study and reverse-complement nucleotides with underlined were showed in Table 1.

A Sal I restriction site in 5' (underlined) and a PshAI restriction site in 3' (underlined) were added in the forward and the reverse primer, respectively.

Loci underlined are located on the N strand.

Residues underlined are C to G mutations in order to construct a C-less cassette.