Sentence examples for underlined into from inspiring English sources

The PCR product was cloned via its introduced restriction sites SacI and SalI (underlined) into the centromeric vector YCplac22 [19], thereby creating the vector YCp- PUN1.

A plasmid containing the functional domain of Sup35, Sup35C, was cloned using primers CCGG CCGCGGATGGTTTGGTGGTAAAGATCACG (forward primer, Sac II site underlined) and CCGG GAGCTCTTACTCGGCAATTTTAACAATTTTACC (reverse primer, Sac I site underlined) into plasmid p2HG [ 49], creating plasmid p2H-SupC.

In summary, two primers (5′ TCGACCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGA G−3′ and 5′ GATCCTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCG G-3′) covering the −49 to +1 region of the CaMV 35S promoter were inserted via SalI and BamHI sites (underlined) into pBI101 to generate pBI/35SM-GUS.

To generate C-terminally triple HA-tagged Pun1p expressed via the strong MET25 promoter, the PUN1 coding sequence was PCR-amplified using the oligonucleotide primers PUN1-SpeI: 5′-AAAC ACTAGTTCGAAGGACGCTATAAGCATGAGG-3′ and PUN1-SalI: 5′-TTTC GTCGACAAATCAATGGTTTTTCCTCAATTGG-3′, and cloned via the SpeI and SalI restriction sites (underlined) into the multicopy vector YEpM351HA [20].

The Xho I and EcoR I sites (underlined) were incorporated into primers to facilitate directional cloning of the PCR product into the polyclonal sites of the expression vector pET28a (Novagen, USA).

coli) using primers ATGTCATATGTTTGAACCAATGGAACTTACC and ATTAGGATCCATCAGCTTGCTTACGCAG, digested with NdeI and BamHI (underlined), and ligated into the similarly digested pET28-M13-rsFastLime pET28-M13-rsFastLime pET28-M13-rsFastLime

The amplified fragment was gel-purified (Qiagen), digested with SfiI and NotI (underlined) and subcloned into the same sites of pCA24N (NBRP NIGG, Japan):E.

Specifically, mEos2 was amplified using primers GATCGAATTCATGAGTGCGATTAAG GATCCTCGAGTTATCGTCTGGCATTGTC, restricted with EcoRI and XhoI (underlined), and ligated into a similarly digested pET28-M13-rsFastLime pET28-M13-rsFastLime pET28-M13-rsFastLimet.

Gene olsB was amplified from BAB-parental using primers olsB- F13 (5' GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGACAGCACTGCTTGGAATGG 3') and gene olsB- R14 (5' GGGGACCACTTTGTACAAGAAAGCTGGGTC CTAGACAAAGCGGTTTGCTTC 3'), that contain the attB sequences (underlined), and cloned into vector pDONR221 (Invitrogen) to generate pLPI-5.

The ftsZ gene was amplified from pJB004 using primers AATTGTCGACAATGTTTGAACCAATGGAACTTAC and TTAAGCGGCCGCTTAATCAGCTTGCTTACGCAG, was restricted with SalI and NotI (underlined), and subcloned into the same sites of pT7HMT [68] creating pJB041.

Several other probable binding registers of 24112 were docked on HLA-DRβ1*0401 but none of them completely displayed the characteristic binding motives of this alleles [25] and none allowed a perfect fit inside the PBR of this MHCII molecule, therefore suggesting that the only probable structure was YNMVIRRSM (underlined residues fit into pockets 1, 4, 6 and 9, respectively).