Sentence examples for underlined in the sequence from inspiring English sources

The resulting vector pCB5-PacI/XmaI has unique PacI and XmaI restriction sites (underlined in the sequence above).

The overlapping regions of the two sets of primers are underlined in the sequence.

The mature miRNA sequence is underlined in the sequence and in the dot-bracket diagram.

Synthesize complementary oligonucleotides that contain a loxP site (underlined in the sequence below) and generate KpnI overhangs (Note: KpnI was chosen because it is a unique restriction site within the vector only).

As a control siRNA, we used a siRNA targeting chick Pbx1 containing two point mutations (underlined in the sequence): 5′-ACACA AAGCTG AAGAAGTA-3′ that show no effect on Pbx1 expression.

Transfection was performed eighteen hours later with a siRNA designed against S100A4 RNA (siS100A4) or with a siS100A4-4 MIS bearing 4 mismatches with respect to siS100A4 (underlined in the sequence below).

Annealed oligonucleotides 5′-CTAGCGTGGA TGATCAAGGTGTGTCTTGTTAGTGGGTCTTATGT CTCGAGGTGGTG-3′ and 5′-AATTCACCAC CTCGAGACATAAGACCCACTAACAAGACACACCT TGATCATCCACG-3′ were cloned into the EcoRI and NheI sites to produce LV-HA-TrkB/oligo, in which we introduced unique BclI and XhoI sites (underlined in the sequences).

A SacII restriction endonuclease site (underlined in the sequences below) was inserted in-frame and directly 5′ of the YCaM3.6 start ATG codon (italics in the sequence below) by site-directed mutagenesis (QuikChange®, Stratagene) using the following primer pair: sense, 5′-AGACCC AAGCTTGCGGCC CCGCGG ATGGTGAGCAAGGGCGAG-3′; and antisense, 5′-CTCGCCCTTGCTCACCAT CCGCGGGGCCGC AAGCTTGGGTCT-3′.

The extremes of the constant sequence (underlined in the library sequence) of the aptamers were complementary, capable of producing a double helix of 13 bases.

The forward template (S1, 109 nt) contained an Eco RI restriction site in a 5'-3' direction (underlined in the S1 sequence) and a T7 promoter sequence downstream (shown in bold in the S1 sequence), separated by four spacer nucleotides.

The comprehensive, high resolution nature of the PBM data provide additional insight into the details of the DNA binding specificity of CSL: the four nucleotides underlined in the consensus sequence are nearly invariant among the bound sequences, whereas nucleotide substitutions at the other four positions are tolerated better.