underlined expression

USAGE SUMMARY

The phrase "underlined expression" is correct and usable in written English.
It can be used to refer to a specific part of a text that has been emphasized by underlining, often in discussions about grammar, style, or textual analysis. Example: "In the sentence, the underlined expression highlights the main idea the author wants to convey."

✓ Grammatically correct

Human-verified similar examples from authoritative sources

Similar Expressions

60 human-written examples

(27) and (28) seem quite a bit like (23) and (24): these each seem to be pairs of sentences which differ in truth-value, despite differing only in the substitution of the underlined expressions.

SEP

Each of them was followed by one up to three supply questions requiring the students to make inferences (3 items), to guess the meaning of words/phrases from context (2 items), to identify the word/pronoun references (2 items), and to paraphrase the underlined expressions or phrases (1 item).

Asian-Pacific Journal of Second and Foreign Language Education

So, for consistency, it seems that the Fregean should explain the apparent difference in truth-value between (27) and (28) in just the way he explains the apparent difference in truth-value between (23) and (24): by positing a difference in meaning between the underlined expressions.

SEP

Intermediate vector pC3.3 was constructed based on pC3.2 by means of the same mutation protocol mentioned above with primer set 5′CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGTTCGAAGGCGGTAATACGGTTATCCACAG 3′ and 5′ AGCCATAGAGCCCACCGCA 3′, by which T7 terminator (underlined sequence) for prokaryotic expression was introduced into a site downstream BGH Poly(A) site.

AMB Express

Underlined font indicates gene expression was also at least 10- to 15-fold greater in MAV compared to both the striatum and parietal cortex.

BMC Genomics

If Fregean descriptivism is true, and 'the greatest philosopher of antiquity' is indeed the description I associate with the name 'Aristotle,' then it seems that (25) and (26) must be a pair of sentences which differ only via the substitution of expressions (the underlined ones) with the same content.

SEP

The crucial role of Sall3 in regulating Lhx1 expression is further underlined by our microarray analysis, which indicates that Lhx1 is one of the most strongly downregulated genes in Sall3−/− retinas.

Development (Cambridge)

Underlined numbers indicate the greatest change in gene expression across varying PCM tumor thickness for each gene.

BMC Medical Genomics

Underlined tag counts indicate statistical significant difference in expression in the original SAGE data sets of PBEC (unstimulated vs. IL1β/TNFα) or KC (unstimulated vs. TNFα).

BMC Genomics

Further continuation with the most likely extension results, for example, in case of human isochore H1 in the expression (CA) CAG(A)(T CTG TG), where the underlined sequence corresponds to the unique non-repeating middle part of the extension.

BMC Genomics

The four underlined gene products from the list in parenthesis were analyzed for mRNA expression in tumors and normal breast tissue.

BMC Cancer

Expert writing Tips

Best practice

When referring to a specific word or phrase within a text, use "underlined expression" to clearly indicate that the element in question is visually emphasized by being underlined. This is especially useful in academic papers or instructional materials where precise referencing is necessary.

Common error

Avoid using "underlined expression" when the emphasis is achieved through other means such as bolding or italics. Using the wrong term can confuse readers about which element you are referring to.

Linguistic Context

The phrase "underlined expression" primarily functions as a noun phrase. It identifies a specific element within a text that has been visually emphasized through underlining. This allows for clear reference and discussion about particular words or phrases. Ludwig AI confirms this is a valid english expression.

Expression frequency: Missing

Frequent in

Science

0%

News & Media

0%

Formal & Business

0%

Less common in

Science

0%

News & Media

0%

Formal & Business

0%

Ludwig's WRAP-UP

In summary, the phrase "underlined expression" serves as a grammatically correct and easily understood way to refer to a specific portion of text that has been emphasized via underlining. While examples of its usage are limited, indicating its relative rareness, Ludwig AI confirms its validity. Semantically related phrases like "highlighted expression" or "emphasized phrase" may serve as suitable substitutes depending on the specific emphasis method employed. When using the phrase, ensure that it accurately reflects the type of emphasis used in the text to avoid ambiguity.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

highlighted expression

Refers to an expression that is emphasized using a different visual cue, such as color or shading, instead of underlining.

emphasized phrase

Indicates that the phrase has been given prominence or importance, which can be achieved through various means including underlining, bolding, or italics.

italicized expression

Specifies that the expression is formatted in italics for emphasis, rather than underlined.

bolded expression

Denotes that the expression is formatted in bold text to make it stand out, as opposed to underlining.

marked expression

A more general term for any expression that has been visually distinguished in some way.

noted expression

Implies that the expression is worthy of attention or has been specifically identified for some reason.

designated phrase

Suggests that the expression has been officially or formally indicated.

specified term

Refers to a particular term that has been explicitly mentioned or defined.

identified wording

Indicates that the specific wording has been recognized or pinpointed.

particular phrase

A general way of referring to a certain phrase without specifying the method of emphasis.

FAQs

How to use "underlined expression" in a sentence?

You can use "underlined expression" to refer to a specific part of a text that is emphasized. For example: "In this document, the "underlined expression" indicates a key term."

What can I say instead of "underlined expression"?

You can use alternatives like "highlighted expression", "emphasized phrase", or "italicized expression" depending on the context.

Which is correct, "underlined expression" or "underlined phrase"?

Both "underlined expression" and "underlined phrase" are correct, but "expression" is more general and can refer to a single word, a group of words, or a symbol. "Phrase" typically refers to a group of words. Choose the one that best fits the specific context.

What's the difference between "underlined expression" and "highlighted expression"?

"Underlined expression" refers to text that has a line drawn beneath it for emphasis. "Highlighted expression" refers to text that has been marked with a different color to make it stand out. The difference lies in the method of emphasis.