Sentence examples for underlined are from inspiring English sources

Interestingly, two of the three nucleotides that are different from the consensus ARE (underlined) are also different in the response elements of both PSA and KLK2.

The printed words on the page, certainly those that are in essence underlined, are there solid, clunky, unmovable, like carbuncles.

The bold words are mapped MeSH terms, and the words underlined are chemical tokens found before or after MeSH terms.

Sequences underlined are corresponding lox sites or their reverse complements.

Sites introduced for directional TOPO® cloning (italics) and restriction enzymes (underlined) are highlighted.

The rot gene was PCR-amplified from 8325-4 chromosomal DNA using the primers KpnI-rotF (5'-TTACCATGGTACC ATTGGGAGATGTTTAGCATG) and SacI-rotR (5'-ACATCAGAGCTC CCAACGTAATCATGCTCCAT) which, except for the added restriction sites (underlined), are the same primers that J. Oscarsson used to clone rot in pWA163 [11].

MluI and HindIII restriction sites (underlined) were introduced through PCRs.

The primers were H1-3.3, 5'- GGATCCUTGGTCTCATACAGAACTTA, where a BamH I site (underlined) was introduced; and Pu-3.1 5'- TCTAGAUTTGCCAAACCTACAGGTGGG, where an Xba I site (underlined) was introduced.

The Australian community, he is keen to underline, is mainly happy with diversity.

So what I am really trying to underline is the importance of this choice.

P values with underline are statistical significant.